Achievement of Koch’s Postulates by Virome Evaluation, Amplification of Full-Size cDNA of Viral Genomes, in vitro Transcription of Infectious Viral RNAs, and Replica of Signs on Fruits


Identification of cell inhibitors in opposition to Chikungunya virus replication by a cDNA expression cloning blended with MinION sequencing


  • cDNA expression cloning has been confirmed to be a robust technique throughout the look for cell parts that administration virus replication. On this look at, cDNA library screening using a pool of cDNA derived from interferon-treated human cells was blended with the MinION sequencer to ascertain cell genes inhibiting Chikungunya virus (CHIKV) replication.


  • Downside an an infection of CHIKV to Vero cells transduced with the cDNA library produced virus-resistant cells. Then, the MinION sequence of cDNAs extracted from the surviving cells revealed that the open finding out frames of TOM7, S100A16, N-terminally truncated kind of ECI1 (ECI1ΔN59), and RPL29 have been inserted in plenty of the cells.


  • Importantly, the transient expression of TOM7, S100A16, and ECI1ΔN59 was found to inhibit the replication of CHIKV in Huh7 cells, indicating that these cell parts have been doubtlessly anti-CHIKV molecules.


  • Thus, our look at demonstrated that cDNA expression cloning blended with the MinION sequencer allowed a quick and full detection of cell inhibitors in opposition to CHIKV. 


XPO6 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against XPO6. Recognizes XPO6 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

XPO6 Rabbit pAb

A10401-100ul 100 ul
EUR 308

XPO6 Rabbit pAb

A10401-200ul 200 ul
EUR 459

XPO6 Rabbit pAb

A10401-20ul 20 ul
EUR 183

XPO6 Rabbit pAb

A10401-50ul 50 ul
EUR 223

XPO6 Blocking Peptide

DF12799-BP 1mg
EUR 195

XPO6 Conjugated Antibody

C46712 100ul
EUR 397

XPO6 cloning plasmid

CSB-CL842747HU1-10ug 10ug
EUR 814
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2514
  • Sequence: atggcgtcagttaacggcagcagccagaactgtgtctcgggtcaggagcgcggccggctgggggtcctggccatgtcctgcatcaatgaactcatgtccaagaactgtgtgcctatggaatttgaggagtatttactgcgtatgttccagcagactttctacctcctgcagaaaa
  • Show more
Description: A cloning plasmid for the XPO6 gene.

XPO6 cloning plasmid

CSB-CL842747HU2-10ug 10ug
EUR 1202
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3378
  • Sequence: atggcatctgaagaagcctctctcagggcattggaaagtctgatgacagaattttttcacgattgtacaaccaatgaaagaaaacgtgagatagaggagcttcttaataactttgcccagcaaataggagcctggagattctgcctgtactttctctccagcactaggaatgact
  • Show more
Description: A cloning plasmid for the XPO6 gene.

anti- XPO6 antibody

FNab09550 100µg
EUR 505.25
  • Recommended dilution: IHC: 1:10-1:100
  • IP: 1:200-1:1000
  • Immunogen: exportin 6
  • Uniprot ID: Q96QU8
  • Gene ID: 23214
  • Research Area: Signal Transduction
Description: Antibody raised against XPO6

Anti-XPO6 antibody

PAab09550 100 ug
EUR 355

Anti-XPO6 antibody

STJ112437 100 µl
EUR 277
Description: The protein encoded by this gene is a member of the importin-beta family. Members of this family are regulated by the GTPase Ran to mediate transport of cargo across the nuclear envelope. This protein has been shown to mediate nuclear export of profilin-actin complexes. A pseudogene of this gene is located on the long arm of chromosome 14. Alternative splicing results in multiple transcript variants that encode different protein isoforms.

Anti-XPO6 antibody

STJ13100475 100 µl
EUR 427

Exportin 6 (XPO6) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Exportin-6 (XPO6) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Exportin-6 (XPO6) Antibody

abx037309-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Exportin-6 (XPO6) Antibody

abx239550-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.


EF004323 96 Tests
EUR 689

Mouse XPO6 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Exportin-6 (XPO6) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Human XPO6 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human Exportin 6 (XPO6) Protein

  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Xpo6 ORF Vector (Mouse) (pORF)

ORF061968 1.0 ug DNA
EUR 506

Xpo6 ORF Vector (Rat) (pORF)

ORF079217 1.0 ug DNA
EUR 506

XPO6 ORF Vector (Human) (pORF)

ORF014966 1.0 ug DNA
EUR 354

XPO6 ORF Vector (Human) (pORF)

ORF011649 1.0 ug DNA
EUR 95

cDNA Synthesis SuperMix

  • EUR 565.00
  • EUR 481.00
  • 100 rxns × 20 ul Systems
  • 50 rxns × 20 ul Systems
  • Shipped within 5-10 working days.

Evo? cDNA Kit

EUR 294

Evo? cDNA Kit

EUR 234

Novo? cDNA Kit

EUR 354

Novo? cDNA Kit

EUR 267

Evo? cDNA Supermix

EUR 381

Evo? cDNA Supermix

EUR 267

Novo? cDNA Supermix

EUR 441

Novo? cDNA Supermix

EUR 289

Human Exportin- 6, XPO6 ELISA KIT

ELI-17963h 96 Tests
EUR 824

Mouse Exportin- 6, Xpo6 ELISA KIT

ELI-51533m 96 Tests
EUR 865

Human Exportin-6 (XPO6) ELISA Kit

abx384332-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Xpo6 sgRNA CRISPR Lentivector set (Mouse)

K4963501 3 x 1.0 ug
EUR 339

Xpo6 sgRNA CRISPR Lentivector set (Rat)

K6323501 3 x 1.0 ug
EUR 339

XPO6 sgRNA CRISPR Lentivector set (Human)

K2650901 3 x 1.0 ug
EUR 339

Human Exportin 6(XPO6)ELISA Kit

QY-E01489 96T
EUR 361

cDNA from Plant Normal Tissue: cDNA from Plant: Arabidopsis

C1634310 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Corn

C1634330 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Orange

C1634340 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Potato

C1634350 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Rice

C1634360 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Wheat

C1634390 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

First-Strand cDNA Synthesis SuperMix (cDNA up to 12 kb)

  • EUR 620.00
  • EUR 523.00
  • 100 rxns × 20 ul Systems
  • 50 rxns × 20 ul Systems
  • Shipped within 5-10 working days.

First-Strand cDNA Synthesis SuperMix (cDNA up to 15 kb)

  • EUR 871.00
  • EUR 662.00
  • 100 rxns × 20 ul Systems
  • 50 rxns × 20 ul Systems
  • Shipped within 5-10 working days.

cDNA from Plant Normal Tissue: cDNA from Plant: Soy bean

C1634370 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA Probe Diluent Solution

AR0063 5mL
EUR 106

cDNA from Arteriosclerosis: Aorta

C1236012Hd-4 40 reactions
EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Artery

C1236013Hd-2 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Arteriosclerosis: Artery

C1236013Hd-4 40 reactions
EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Vein

C1236020Hd-2 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Colon

C1236090Lup 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Heart

C1236122Hd-2 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Heart

C1236122Lup 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Kidney

C1236142Hd-2 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Kidney

C1236142Lup 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Liver

C1236149Lup 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Asthma: Lung

C1236152Ld-1 40 reactions
EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Bronchitis: Lung

C1236152Ld-2 40 reactions
EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Emphysema: Lung

C1236152Ld-3 40 reactions
EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Pneumonia: Lung

C1236152Ld-4 40 reactions
EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Lung

C1236152Lup 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Pancreas

C1236188Lup 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Spleen

C1236246Lup 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: stomach

C1236248Lup 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

Tetro cDNA Synthesis Kit

BIO-65042 30 Reactions Ask for price

Tetro cDNA Synthesis Kit

BIO-65043 100 Reactions Ask for price

SensiFAST cDNA Synthesis Kit

BIO-65053 50 Reactions Ask for price

SensiFAST cDNA Synthesis Kit

BIO-65053/S Sample Ask for price

SensiFAST cDNA Synthesis Kit

BIO-65054 250 Reactions Ask for price

OneScriptPlus cDNA Synthesis Kit

G235 25 x 20 ul reactions
EUR 97

OneScriptPlus cDNA Synthesis Kit

G236 100 x 20 ul reactions
EUR 169

OneScriptPlus cDNA Synthesis SuperMix

G453 25 x 20 ul reactions
EUR 97

OneScriptPlus cDNA Synthesis SuperMix

G454 100 x 20 ul reactions
EUR 169

circRNA cDNA Synthesis Kit

G627 25 rxn (20 ul/rxn)
EUR 309

Human eNOS cDNA probe

eNOS51-D-2 2 ug
EUR 445

Novo? Transcriptome cDNA Kit

EUR 952

Novo? Transcriptome cDNA Kit

EUR 441

Plant Tissue cDNA: Arabidopsis

PC34-310 10 rxn
EUR 415

Xpo6 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4963502 1.0 ug DNA
EUR 154

Xpo6 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4963503 1.0 ug DNA
EUR 154

Xpo6 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4963504 1.0 ug DNA
EUR 154

Xpo6 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6323502 1.0 ug DNA
EUR 154

Xpo6 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6323503 1.0 ug DNA
EUR 154

Xpo6 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6323504 1.0 ug DNA
EUR 154

XPO6 sgRNA CRISPR Lentivector (Human) (Target 1)

K2650902 1.0 ug DNA
EUR 154

XPO6 sgRNA CRISPR Lentivector (Human) (Target 2)

K2650903 1.0 ug DNA
EUR 154

XPO6 sgRNA CRISPR Lentivector (Human) (Target 3)

K2650904 1.0 ug DNA
EUR 154


Identification of a novel KIR3DL3*064 allele by cDNA cloning and sequencing

Purpose: To report on a novel KIR3DL3 allele acknowledged in a southern Han Chinese language language specific particular person.


Methods: Peripheral blood sample was collected from a voluntary blood donor with inconclusive end result by KIR3DL3 sequence-based typing (SBT). Entire mRNA was extracted and subjected to reverse transcription to amass KIR3DL3 cDNA, which was then amplified by PCR with a pair of KIR3DL3-specific primers. The product was subjected to cDNA cloning and sequencing.


Outcomes: cDNA cloning and sequencing have acknowledged a wide-type KIR3DL3*00802 allele and a novel KIR3DL3*064 allele. The latter differed from KIR3DL3*00601 by a missense variant at codon 374[c.1184 C>T (p.Thr374Ile)] in exon 9. The novel KIR3DL3 allele has been formally assigned by the KIR subcommittee of World Effectively being Group Nomenclature Committee for parts of HLA system.


Conclusion: cDNA cloning and sequencing is also used to inform aside inconclusive ends in KIR3DL3 SBT with a function to ascertain novel KIR alleles.


Apple Russet Ring and Apple Inexperienced Crinkle Sicknesses: Achievement of Koch’s Postulates by Virome Analysis, Amplification of Full-Measurement cDNA of Viral Genomes, in vitro Transcription of Infectious Viral RNAs, and Duplicate of Indicators on Fruits of Apple Bushes Inoculated With Viral RNAs



Apple russet ring and apple inexperienced crinkle are graft-transmitted diseases first reported better than 60 years prior to now, nonetheless at present, no affiliation between a specific virus (variant) and the sickness has been clearly demonstrated.


On this look at, we carried out the following assortment of experiments to ascertain the causal viruses (variants) of these apple diseases; (1) full analysis by next-generation sequencing of all viruses in each apple tree affected with russet ring or inexperienced crinkle sickness,


(2) amplification of full-length genomic cDNA of viruses using primers containing the T3 promoter and the in vitro transcription of infectious viral RNAs, (3) inoculation of viral RNA transcripts to every herbaceous and apple crops, (4) analysis of sequence variants of viruses present in contaminated crops, (5) back-inoculation of sequence variants of candidate viruses to apple seedlings blended with the virus-induced flowering know-how using the apple latent spherical virus vector to breed the symptom on the fruit as shortly as doable, and


(6) reproduction of indicators on the fruits of apple timber inoculated with sequence variants and the re-isolation of each virus variant from apples exhibiting fruit indicators.


The outcomes confirmed that considered one of many sequence variants of the apple chlorotic leaf spot virus causes a attribute ring-shaped rust on the fruits of contaminated apple timber and {{that a}} sequence variant of the apple stem pitting virus most likely causes inexperienced crinkle indicators on an contaminated apple fruit.


Thus, we now have been able to fulfill Koch’s postulates to point out the viral etiology of every the apple russet ring and inexperienced crinkle diseases. We moreover recommend an experimental system which will present whether or not or not a virus current in diseased tissues is the pathogen chargeable for the diseases when the etiology is undetermined.


Human Phospholipid Transfer Protein (PLTP) ELISA Kit
RD-PLTP-Hu-48Tests 48 Tests
EUR 521
Human Phospholipid Transfer Protein (PLTP) ELISA Kit
RD-PLTP-Hu-96Tests 96 Tests
EUR 723
Rat Phospholipid Transfer Protein (PLTP) ELISA Kit
RD-PLTP-Ra-48Tests 48 Tests
EUR 557
Rat Phospholipid Transfer Protein (PLTP) ELISA Kit
RD-PLTP-Ra-96Tests 96 Tests
EUR 775
Human Phospholipid Transfer Protein (PLTP) ELISA Kit
RDR-PLTP-Hu-48Tests 48 Tests
EUR 544
Human Phospholipid Transfer Protein (PLTP) ELISA Kit
RDR-PLTP-Hu-96Tests 96 Tests
EUR 756
Rat Phospholipid Transfer Protein (PLTP) ELISA Kit
RDR-PLTP-Ra-48Tests 48 Tests
EUR 583
Rat Phospholipid Transfer Protein (PLTP) ELISA Kit
RDR-PLTP-Ra-96Tests 96 Tests
EUR 811
Monoclonal PLTP Antibody (monoclonal) (M01), Clone: 2F3-G4
AMR09390G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human PLTP (monoclonal) (M01). The antibodies are raised in mouse and are from clone 2F3-G4. This antibody is applicable in WB and IHC
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
PLTP Antibody
ABD7426 100 ug
EUR 438
PLTP Antibody
EUR 327
PLTP Antibody
EUR 146
PLTP Antibody
32933-100ul 100ul
EUR 252
PLTP antibody
70R-11938 100 ug
EUR 418
Description: Rabbit polyclonal PLTP antibody
PLTP antibody
70R-10288 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal PLTP antibody
PLTP Antibody
DF7426 200ul
EUR 304
Description: PLTP Antibody detects endogenous levels of total PLTP.
PLTP Antibody
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PLTP. Recognizes PLTP from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000
PLTP Antibody
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PLTP. Recognizes PLTP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
PVT12200 2 ug
EUR 391
YF-PA13839 50 ul
EUR 363
Description: Mouse polyclonal to PLTP
YF-PA13840 100 ug
EUR 403
Description: Rabbit polyclonal to PLTP
YF-PA24404 50 ul
EUR 334
Description: Mouse polyclonal to PLTP
Recombinant Phospholipid Transfer Protein (PLTP)
  • EUR 503.20
  • EUR 238.00
  • EUR 1612.00
  • EUR 604.00
  • EUR 1108.00
  • EUR 400.00
  • EUR 3880.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P55065
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 19.4kDa
  • Isoelectric Point: 10.1
Description: Recombinant Mouse Phospholipid Transfer Protein expressed in: E.coli
Recombinant Phospholipid Transfer Protein (PLTP)
  • EUR 469.15
  • EUR 229.00
  • EUR 1484.32
  • EUR 561.44
  • EUR 1022.88
  • EUR 377.00
  • EUR 3560.80
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: E9PSP1
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 19.3kDa
  • Isoelectric Point: Inquire
Description: Recombinant Rat Phospholipid Transfer Protein expressed in: E.coli
Polyclonal PLTP Antibody
AMR09385G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PLTP . This antibody is tested and proven to work in the following applications:
Polyclonal PLTP Antibody
AMR09386G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PLTP . This antibody is tested and proven to work in the following applications:
Polyclonal PLTP Antibody
AMR09387G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PLTP . This antibody is tested and proven to work in the following applications:
PLTP Conjugated Antibody
C32933 100ul
EUR 397
PLTP cloning plasmid
CSB-CL018212HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1482
  • Sequence: atggccctcttcggggccctcttcctagcgctgctggcaggcgcacatgcagtgttcccaggctgcaagatccgcgtcacctccaaggcgctggagctggtgaagcaggaggggctgcgctttctggagcaagagctggagactatcaccattccggacctgcggggcaaagaag
  • Show more
Description: A cloning plasmid for the PLTP gene.
PLTP cloning plasmid
CSB-CL018212HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1326
  • Sequence: atggccctcttcggggccctcttcctagcgctgctggcaggcgcacatgcagagttcccaggctgcaagatccgcgtcacctccaaggcgctggagctggtgaagcaggaggggctgcgctttctggagcaagagctggagactatcaccattccggacctgcggggcaaagaag
  • Show more
Description: A cloning plasmid for the PLTP gene.
PLTP Polyclonal Antibody
ES10007-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against PLTP from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
PLTP Polyclonal Antibody
ES10007-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against PLTP from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
PLTP Polyclonal Antibody
ABP59951-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human PLTP protein at amino acid sequence of 180-260
  • Applications tips:
Description: A polyclonal antibody for detection of PLTP from Human, Mouse. This PLTP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PLTP protein at amino acid sequence of 180-260
PLTP Polyclonal Antibody
ABP59951-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human PLTP protein at amino acid sequence of 180-260
  • Applications tips:
Description: A polyclonal antibody for detection of PLTP from Human, Mouse. This PLTP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PLTP protein at amino acid sequence of 180-260
PLTP Polyclonal Antibody
ABP59951-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human PLTP protein at amino acid sequence of 180-260
  • Applications tips:
Description: A polyclonal antibody for detection of PLTP from Human, Mouse. This PLTP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PLTP protein at amino acid sequence of 180-260
PLTP Rabbit pAb
A5628-100ul 100 ul
EUR 308
PLTP Rabbit pAb
A5628-200ul 200 ul
EUR 459
PLTP Rabbit pAb
A5628-20ul 20 ul
EUR 183
PLTP Rabbit pAb
A5628-50ul 50 ul
EUR 223
PLTP Polyclonal Antibody
A53320 100 µg
EUR 570.55
Description: The best epigenetics products
PLTP Blocking Peptide
33R-6693 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PLTP antibody, catalog no. 70R-10288
PLTP Blocking Peptide
33R-10824 50 ug
EUR 191
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PLTP antibody, catalog no. 70R-11938
PLTP Blocking Peptide
EUR 153
PLTP Blocking Peptide
DF7426-BP 1mg
EUR 195
Anti-PLTP Antibody
PA2228 100ug/vial
EUR 334
Anti-PLTP antibody
STJ27595 100 µl
EUR 277
Description: The protein encoded by this gene is one of at least two lipid transfer proteins found in human plasma. The encoded protein transfers phospholipids from triglyceride-rich lipoproteins to high density lipoprotein (HDL). In addition to regulating the size of HDL particles, this protein may be involved in cholesterol metabolism. At least two transcript variants encoding different isoforms have been found for this gene.
Anti-PLTP antibody
STJ191165 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to PLTP
Phospholipid Transfer Protein (PLTP) Polyclonal Antibody (Mouse)
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLTP (Ile337~Asp479)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Phospholipid Transfer Protein (PLTP)
Phospholipid Transfer Protein (PLTP) Polyclonal Antibody (Rat)
  • EUR 259.00
  • EUR 2708.00
  • EUR 670.00
  • EUR 328.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLTP (Ile337~Gly479)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Phospholipid Transfer Protein (PLTP)
Human Phospholipid Transfer Protein (PLTP) ELISA Kit
SEC728Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Phospholipid Transfer Protein (PLTP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Phospholipid Transfer Protein (PLTP) in serum, plasma, tissue homogenates and other biological fluids.
Human Phospholipid Transfer Protein (PLTP) ELISA Kit
SEC728Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Phospholipid Transfer Protein (PLTP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Phospholipid Transfer Protein (PLTP) in serum, plasma, tissue homogenates and other biological fluids.
Human Phospholipid Transfer Protein (PLTP) ELISA Kit
SEC728Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Phospholipid Transfer Protein (PLTP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Phospholipid Transfer Protein (PLTP) in serum, plasma, tissue homogenates and other biological fluids.
Human Phospholipid Transfer Protein (PLTP) ELISA Kit
SEC728Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Phospholipid Transfer Protein (PLTP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Phospholipid Transfer Protein (PLTP) in serum, plasma, tissue homogenates and other biological fluids.
Human Phospholipid Transfer Protein (PLTP) ELISA Kit
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Phospholipid Transfer Protein elisa. Alternative names of the recognized antigen: Lipid transfer protein II
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Phospholipid Transfer Protein (PLTP) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.
Mouse Phospholipid Transfer Protein (PLTP) ELISA Kit
SEC728Mu-10x96wellstestplate 10x96-wells test plate
EUR 4862.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Phospholipid Transfer Protein (PLTP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Phospholipid Transfer Protein (PLTP) in serum, plasma and other biological fluids.
Mouse Phospholipid Transfer Protein (PLTP) ELISA Kit
SEC728Mu-1x48wellstestplate 1x48-wells test plate
EUR 488.08
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Phospholipid Transfer Protein (PLTP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Phospholipid Transfer Protein (PLTP) in serum, plasma and other biological fluids.
Mouse Phospholipid Transfer Protein (PLTP) ELISA Kit
SEC728Mu-1x96wellstestplate 1x96-wells test plate
EUR 654.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Phospholipid Transfer Protein (PLTP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Phospholipid Transfer Protein (PLTP) in serum, plasma and other biological fluids.
Mouse Phospholipid Transfer Protein (PLTP) ELISA Kit
SEC728Mu-5x96wellstestplate 5x96-wells test plate
EUR 2644.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Phospholipid Transfer Protein (PLTP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Phospholipid Transfer Protein (PLTP) in serum, plasma and other biological fluids.
Mouse Phospholipid Transfer Protein (PLTP) ELISA Kit
  • EUR 4913.00
  • EUR 2595.00
  • EUR 655.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Phospholipid Transfer Protein elisa. Alternative names of the recognized antigen: Lipid transfer protein II
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Phospholipid Transfer Protein (PLTP) in samples from Serum, plasma and other biological fluids with no significant corss-reactivity with analogues from other species.
Rat Phospholipid Transfer Protein (PLTP) ELISA Kit
SEC728Ra-10x96wellstestplate 10x96-wells test plate
EUR 5124.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Phospholipid Transfer Protein (PLTP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: C
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Phospholipid Transfer Protein (PLTP) in serum, plasma, tissue homogenates and other biological fluids.
Rat Phospholipid Transfer Protein (PLTP) ELISA Kit
SEC728Ra-1x48wellstestplate 1x48-wells test plate
EUR 509.64
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Phospholipid Transfer Protein (PLTP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: C
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Phospholipid Transfer Protein (PLTP) in serum, plasma, tissue homogenates and other biological fluids.
Rat Phospholipid Transfer Protein (PLTP) ELISA Kit
SEC728Ra-1x96wellstestplate 1x96-wells test plate
EUR 685.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Phospholipid Transfer Protein (PLTP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: C
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Phospholipid Transfer Protein (PLTP) in serum, plasma, tissue homogenates and other biological fluids.
Rat Phospholipid Transfer Protein (PLTP) ELISA Kit
SEC728Ra-5x96wellstestplate 5x96-wells test plate
EUR 2783.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Phospholipid Transfer Protein (PLTP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: C
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Phospholipid Transfer Protein (PLTP) in serum, plasma, tissue homogenates and other biological fluids.
Rat Phospholipid Transfer Protein (PLTP) ELISA Kit
  • EUR 5175.00
  • EUR 2734.00
  • EUR 686.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Phospholipid Transfer Protein elisa. Alternative names of the recognized antigen: Lipid transfer protein II
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Phospholipid Transfer Protein (PLTP) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.
Phospholipid Transfer Protein (PLTP) Polyclonal Antibody (Mouse), APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLTP (Ile337~Asp479)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Phospholipid Transfer Protein (PLTP). This antibody is labeled with APC.
Phospholipid Transfer Protein (PLTP) Polyclonal Antibody (Mouse), Biotinylated
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLTP (Ile337~Asp479)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Phospholipid Transfer Protein (PLTP). This antibody is labeled with Biotin.
Phospholipid Transfer Protein (PLTP) Polyclonal Antibody (Mouse), Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLTP (Ile337~Asp479)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Phospholipid Transfer Protein (PLTP). This antibody is labeled with Cy3.
Phospholipid Transfer Protein (PLTP) Polyclonal Antibody (Mouse), FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLTP (Ile337~Asp479)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Phospholipid Transfer Protein (PLTP). This antibody is labeled with FITC.
Phospholipid Transfer Protein (PLTP) Polyclonal Antibody (Mouse), HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLTP (Ile337~Asp479)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Phospholipid Transfer Protein (PLTP). This antibody is labeled with HRP.
Phospholipid Transfer Protein (PLTP) Polyclonal Antibody (Mouse), PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLTP (Ile337~Asp479)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Phospholipid Transfer Protein (PLTP). This antibody is labeled with PE.
Phospholipid Transfer Protein (PLTP) Polyclonal Antibody (Rat), APC
  • EUR 364.00
  • EUR 3545.00
  • EUR 980.00
  • EUR 467.00
  • EUR 227.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLTP (Ile337~Gly479)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Phospholipid Transfer Protein (PLTP). This antibody is labeled with APC.
Phospholipid Transfer Protein (PLTP) Polyclonal Antibody (Rat), Biotinylated
  • EUR 325.00
  • EUR 2658.00
  • EUR 777.00
  • EUR 400.00
  • EUR 225.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLTP (Ile337~Gly479)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Phospholipid Transfer Protein (PLTP). This antibody is labeled with Biotin.
Phospholipid Transfer Protein (PLTP) Polyclonal Antibody (Rat), Cy3
  • EUR 444.00
  • EUR 4685.00
  • EUR 1265.00
  • EUR 581.00
  • EUR 261.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLTP (Ile337~Gly479)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Phospholipid Transfer Protein (PLTP). This antibody is labeled with Cy3.
Phospholipid Transfer Protein (PLTP) Polyclonal Antibody (Rat), FITC
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLTP (Ile337~Gly479)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Phospholipid Transfer Protein (PLTP). This antibody is labeled with FITC.
Phospholipid Transfer Protein (PLTP) Polyclonal Antibody (Rat), HRP
  • EUR 332.00
  • EUR 3089.00
  • EUR 866.00
  • EUR 421.00
  • EUR 213.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLTP (Ile337~Gly479)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Phospholipid Transfer Protein (PLTP). This antibody is labeled with HRP.
Phospholipid Transfer Protein (PLTP) Polyclonal Antibody (Rat), PE
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLTP (Ile337~Gly479)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Phospholipid Transfer Protein (PLTP). This antibody is labeled with PE.
EHP0138 96Tests
EUR 521
EGTP0138 96Tests
EUR 521
EBP0138 96Tests
EUR 521
Chicken PLTP ELISA Kit
ECKP0138 96Tests
EUR 521
Anserini PLTP ELISA Kit
EAP0138 96Tests
EUR 521
ECP0138 96Tests
EUR 521
EF007098 96 Tests
EUR 689
Porcine PLTP ELISA Kit
EPP0138 96Tests
EUR 521
ERP0138 96Tests
EUR 521
ERTP0138 96Tests
EUR 521
ESP0138 96Tests
EUR 521
EMKP0138 96Tests
EUR 521
EMP0138 96Tests
EUR 521
Human PLTP shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse PLTP shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
PLTP Antibody, HRP conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PLTP. Recognizes PLTP from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
PLTP Antibody, FITC conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PLTP. Recognizes PLTP from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
PLTP Antibody, Biotin conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PLTP. Recognizes PLTP from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
PLTP Recombinant Protein (Human)
RP023854 100 ug Ask for price
PLTP Recombinant Protein (Human)
RP023857 100 ug Ask for price
PLTP Recombinant Protein (Rat)
RP221072 100 ug Ask for price
PLTP Recombinant Protein (Mouse)
RP162998 100 ug Ask for price
Anti-PLTP (2F3-G4)
YF-MA10707 100 ug
EUR 363
Description: Mouse monoclonal to PLTP
cDNA Synthesis SuperMix
  • EUR 565.00
  • EUR 481.00
  • 100 rxns × 20 ul Systems
  • 50 rxns × 20 ul Systems
  • Shipped within 5-10 working days.
Evo? cDNA Kit
EUR 294
Evo? cDNA Kit
EUR 234
Novo? cDNA Kit
EUR 354
Novo? cDNA Kit
EUR 267
Evo? cDNA Supermix
EUR 381
Evo? cDNA Supermix
EUR 267
Novo? cDNA Supermix
EUR 441
Novo? cDNA Supermix
EUR 289
Phospholipid Transfer Protein (PLTP) Polyclonal Antibody (Mouse), APC-Cy7
  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLTP (Ile337~Asp479)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Phospholipid Transfer Protein (PLTP). This antibody is labeled with APC-Cy7.
Phospholipid Transfer Protein (PLTP) Polyclonal Antibody (Rat), APC-Cy7
  • EUR 608.00
  • EUR 6970.00
  • EUR 1840.00
  • EUR 814.00
  • EUR 335.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLTP (Ile337~Gly479)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Phospholipid Transfer Protein (PLTP). This antibody is labeled with APC-Cy7.
cDNA from Plant Normal Tissue: cDNA from Plant: Arabidopsis
C1634310 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Plant Normal Tissue: cDNA from Plant: Corn
C1634330 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Plant Normal Tissue: cDNA from Plant: Orange
C1634340 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Plant Normal Tissue: cDNA from Plant: Potato
C1634350 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Plant Normal Tissue: cDNA from Plant: Rice
C1634360 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Plant Normal Tissue: cDNA from Plant: Wheat
C1634390 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
Polyclonal PLTP Antibody (aa470-490)
AMR09388G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PLTP (aa470-490). This antibody is tested and proven to work in the following applications:
Polyclonal PLTP Antibody (C-term)
AMR09389G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PLTP (C-term). This antibody is tested and proven to work in the following applications:
Mouse PLTP PicoKine ELISA Kit
EK1368 96 wells
EUR 425
Description: For quantitative detection of mouse PLTP in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).
ELISA kit for Mouse PLTP
EK5632 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse PLTP in samples from serum, plasma, tissue homogenates and other biological fluids.
Guinea Pig PLTP ELISA Kit
EGP0138 96Tests
EUR 521
Phospholipid Transfer Protein (PLTP) Antibody
  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Phospholipid Transfer Protein (PLTP) Antibody
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Phospholipid Transfer Protein (PLTP) Antibody
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.
Phospholipid Transfer Protein (PLTP) Antibody
abx146426-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Phospholipid Transfer Protein (PLTP) Antibody
abx033529-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Phospholipid Transfer Protein (PLTP) Antibody
abx033529-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Phospholipid Transfer Protein (PLTP) Antibody
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Phospholipid Transfer Protein (PLTP) Antibody
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.
Phospholipid Transfer Protein (PLTP) Antibody
  • EUR 913.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.
Phospholipid Transfer Protein (PLTP) Antibody
  • EUR 1205.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.
Phospholipid Transfer Protein (PLTP) Antibody
  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.
Phospholipid Transfer Protein (PLTP) Antibody
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
PLTP Polyclonal Antibody, Biotin Conjugated
A53317 100 µg
EUR 570.55
Description: Ask the seller for details
PLTP Polyclonal Antibody, FITC Conjugated
A53318 100 µg
EUR 570.55
Description: The best epigenetics products
PLTP Polyclonal Antibody, HRP Conjugated
A53319 100 µg
EUR 570.55
Description: kits suitable for this type of research
PLTP Inhibitor Drug Screening Kit
55R-1448 100 assays
EUR 920
Description: Screening Kit for detection of PLTP Inhibitor in the research laboratory
PLTP Activity Fluorometric Assay Kit
K2087-100 100 assays
EUR 669
Human Phospholipid transfer protein (PLTP)
  • EUR 430.00
  • EUR 234.00
  • EUR 1508.00
  • EUR 642.00
  • EUR 1009.00
  • EUR 291.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 55.1 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Phospholipid transfer protein(PLTP) expressed in Yeast
Human Phospholipid transfer protein (PLTP)
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 80.1 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Phospholipid transfer protein(PLTP) expressed in E.coli
PLTP ORF Vector (Human) (pORF)
ORF007952 1.0 ug DNA
EUR 95
PLTP ORF Vector (Human) (pORF)
ORF007953 1.0 ug DNA
EUR 95
Pltp ORF Vector (Rat) (pORF)
ORF073692 1.0 ug DNA
EUR 506
Pltp ORF Vector (Mouse) (pORF)
ORF054334 1.0 ug DNA
EUR 506
PLTP ELISA Kit (Human) (OKCD01695)
OKCD01695 96 Wells
EUR 831
Description: Description of target: Facilitates the transfer of a spectrum of different lipid molecules, including diacylglycerol, phosphatidic acid, sphingomyelin, phosphatidylcholine, phosphatidylglycerol, cerebroside and phosphatidyl ethanolamine. Essential for the transfer of excess surface lipids from triglyceride-rich lipoproteins to HDL, thereby facilitating the formation of smaller lipoprotein remnants, contributing to the formation of LDL, and assisting in the maturation of HDL particles. PLTP also plays a key role in the uptake of cholesterol from peripheral cells and tissues that is subsequently transported to the liver for degradation and excretion. Two distinct forms of PLTP exist in plasma: an active form that can transfer PC from phospholipid vesicles to high-density lipoproteins (HDL), and an inactive form that lacks this capability. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.135 ng/mL
PLTP ELISA Kit (Human) (OKAN06516)
OKAN06516 96 Wells
EUR 792
Description: Description of target: The protein encoded by this gene is one of at least two lipid transfer proteins found in human plasma. The encoded protein transfers phospholipids from triglyceride-rich lipoproteins to high density lipoprotein (HDL). In addition to regulating the size of HDL particles, this protein may be involved in cholesterol metabolism. At least two transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.135 ng/mL
PLTP ELISA Kit (Rat) (OKCD04388)
OKCD04388 96 Wells
EUR 936
Description: Description of target: ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 1.4 ng/mL
PLTP ELISA Kit (Mouse) (OKCD08236)
OKCD08236 96 Wells
EUR 1001
Description: Description of target: Phospholipid transfer protein (PLTP), also known as lipid transfer protein II is a protein that in humans is encoded by the PLTP gene. This gene is mapped to 20q13.12. The protein encoded by this gene is one of at least two lipid transfer proteins found in human plasma. The encoded protein transfers phospholipids from triglyceride-rich lipoproteins to high density lipoprotein (HDL). In addition to regulating the size of HDL particles, this protein may be involved in cholesterol metabolism. At least two transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 31pg/mL
PLTP ELISA Kit (Mouse) (OKBB00625)
OKBB00625 96 Wells
EUR 505
Description: Description of target: Phospholipid transfer protein (PLTP), also known as lipid transfer protein II is a protein that in humans is encoded by the PLTP gene. This gene is mapped to 20q13.12. The protein encoded by this gene is one of at least two lipid transfer proteins found in human plasma. The encoded protein transfers phospholipids from triglyceride-rich lipoproteins to high density lipoprotein (HDL). In addition to regulating the size of HDL particles, this protein may be involved in cholesterol metabolism. At least two transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: <= 20 pg/mL
PLTP ELISA Kit (Human) (OKCA02131)
OKCA02131 96 Wells
EUR 917
Description: Description of target: Facilitates the transfer of a spectrum of different lipid molecules, including diacylglycerol, phosphatidic acid, sphingomyelin, phosphatidylcholine, phosphatidylglycerol, cerebroside and phosphatidyl ethanolamine. Essential for the transfer of excess surface lipids from triglyceride-rich lipoproteins to HDL, thereby facilitating the formation of smaller lipoprotein remnants, contributing to the formation of LDL, and assisting in the maturation of HDL particles. PLTP also plays a key role in the uptake of cholesterol from peripheral cells and tissues that is subsequently transported to the liver for degradation and excretion. Two distinct forms of PLTP exist in plasma: an active form that can transfer PC from phospholipid vesicles to high-density lipoproteins (HDL), and an inactive form that lacks this capability. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.58 ng/mL
cDNA from Plant Normal Tissue: cDNA from Plant: Soy bean
C1634370 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
First-Strand cDNA Synthesis SuperMix (cDNA up to 12 kb)
  • EUR 620.00
  • EUR 523.00
  • 100 rxns × 20 ul Systems
  • 50 rxns × 20 ul Systems
  • Shipped within 5-10 working days.
First-Strand cDNA Synthesis SuperMix (cDNA up to 15 kb)
  • EUR 871.00
  • EUR 662.00
  • 100 rxns × 20 ul Systems
  • 50 rxns × 20 ul Systems
  • Shipped within 5-10 working days.
cDNA Probe Diluent Solution
AR0063 5mL
EUR 106
Tetro cDNA Synthesis Kit
BIO-65042 30 Reactions Ask for price
Tetro cDNA Synthesis Kit
BIO-65043 100 Reactions Ask for price
SensiFAST cDNA Synthesis Kit
BIO-65053 50 Reactions Ask for price
SensiFAST cDNA Synthesis Kit
BIO-65053/S Sample Ask for price
SensiFAST cDNA Synthesis Kit
BIO-65054 250 Reactions Ask for price
cDNA from Arteriosclerosis: Aorta
C1236012Hd-4 40 reactions
EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from hypertension: Artery
C1236013Hd-2 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Arteriosclerosis: Artery
C1236013Hd-4 40 reactions
EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from hypertension: Vein
C1236020Hd-2 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Lupus: Colon
C1236090Lup 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from hypertension: Heart
C1236122Hd-2 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Lupus: Heart
C1236122Lup 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from hypertension: Kidney
C1236142Hd-2 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Lupus: Kidney
C1236142Lup 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

Leave a Reply

Your email address will not be published. Required fields are marked *