Full-Dimension cDNA Infectious Clones of Soybean Mosaic Virus

In-Yeast Assembly of Coronavirus Infectious cDNA Clones Using a Synthetic Genomics Pipeline

 

The Escherichia coli and vaccinia virus-based reverse genetics strategies have been broadly utilized for the manipulation and engineering of coronavirus genomes. These strategies, nonetheless, present numerous limitations and are usually robust to find out in a effectively timed methodology for (re-)rising viruses. On this chapter, we present a model new frequent reverse genetics platform for the assembly and engineering of infectious full-length cDNAs using yeast-based transformation-associated recombination cloning.

 

This novel assembly approach not solely ends in safe coronavirus infectious full-length cDNAs cloned throughout the yeast Saccharomyces cerevisiae however moreover fosters and accelerates the manipulation of their genomes.

 

Such a platform is broadly related for the scientific neighborhood, as a result of it requires no explicit gear and may very well be carried out in an abnormal laboratory setting. The protocol described may very well be merely tailor-made to only about all acknowledged or rising coronaviruses, paying homage to Heart East respiratory syndrome coronavirus (MERS-CoV).

 

cDNA from Monkey (Rhesus) Normal Tissue: Brain
C1534035	Biochain	40 reactions	EUR 376
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Monkey (Rhesus) Normal Tissue: Cecum
C1534089	Biochain	40 reactions	EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Monkey (Rhesus) Normal Tissue: Colon
C1534090	Biochain	40 reactions	EUR 376
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Monkey (Rhesus) Normal Tissue: Epididymis
C1534105	Biochain	40 reactions	EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Monkey (Rhesus) Normal Tissue: Esophagus
C1534106	Biochain	40 reactions	EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Monkey (Rhesus) Normal Tissue: Gallbladder
C1534118	Biochain	40 reactions	EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Monkey (Rhesus) Normal Tissue: Heart
C1534122	Biochain	40 reactions	EUR 376
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Monkey (Rhesus) Normal Tissue: Kidney
C1534142	Biochain	40 reactions	EUR 376
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Monkey (Rhesus) Normal Tissue: Liver
C1534149	Biochain	40 reactions	EUR 376
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Monkey (Rhesus) Normal Tissue: Lung
C1534152	Biochain	40 reactions	EUR 376
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Monkey (Rhesus) Normal Tissue: Trachea
C1534160	Biochain	40 reactions	EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Monkey (Rhesus) Normal Tissue: Diaphragm
C1534169	Biochain	40 reactions	EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Monkey (Rhesus) Normal Tissue: Ovary
C1534183	Biochain	40 reactions	EUR 939
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Monkey (Rhesus) Normal Tissue: Pancreas
C1534188	Biochain	40 reactions	EUR 376
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Monkey (Rhesus) Normal Tissue: Parathyroid
C1534189	Biochain	40 reactions	EUR 1051
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Monkey (Rhesus) Normal Tissue: Parotid
C1534190	Biochain	40 reactions	EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Monkey (Rhesus) Normal Tissue: Penis
C1534194	Biochain	40 reactions	EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Monkey (Rhesus) Normal Tissue: Placenta
C1534200	Biochain	40 reactions	EUR 376
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Monkey (Rhesus) Normal Tissue: Prostate
C1534201	Biochain	40 reactions	EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Monkey (Rhesus) Normal Tissue: Rectum
C1534206	Biochain	40 reactions	EUR 376
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Monkey (Rhesus) Normal Tissue: Skin
C1534218	Biochain	40 reactions	EUR 376
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Monkey (Rhesus) Normal Tissue: Spleen
C1534246	Biochain	40 reactions	EUR 376
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Monkey (Rhesus) Normal Tissue: Stomach
C1534248	Biochain	40 reactions	EUR 376
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Monkey (Rhesus) Normal Tissue: Testis
C1534260	Biochain	40 reactions	EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Monkey (Rhesus) Normal Tissue: Throat
C1534263	Biochain	40 reactions	EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Monkey (Rhesus) Normal Tissue: Thymus
C1534264	Biochain	40 reactions	EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Monkey (Rhesus) Normal Tissue: Thyroid
C1534265	Biochain	40 reactions	EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Monkey (Rhesus) Normal Tissue: Tongue
C1534267	Biochain	40 reactions	EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Monkey (Rhesus) Normal Tissue: Tonsil
C1534268	Biochain	40 reactions	EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Monkey (Rhesus) Normal Tissue: Ureter
C1534273	Biochain	40 reactions	EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Monkey (Rhesus) Normal Tissue: Uterus
C1534274	Biochain	40 reactions	EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Monkey (Rhesus) Normal Tissue: Vagina
C1534283	Biochain	40 reactions	EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Monkey (Rhesus) Normal Tissue: Colon Ascending
C1534091	Biochain	40 reactions	EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Monkey (Rhesus) Normal Tissue: Colon descending
C1534092	Biochain	40 reactions	EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Monkey (Rhesus) Normal Tissue: Colon Sigmoid
C1534095	Biochain	40 reactions	EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Monkey (Rhesus) Normal Tissue: Colon Transverse
C1534096	Biochain	40 reactions	EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Monkey (Rhesus) Normal Tissue: Ductus Deferens
C1534100	Biochain	40 reactions	EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Monkey (Rhesus) Normal Tissue: Fallopian Tube
C1534115	Biochain	40 reactions	EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Monkey (Rhesus) Normal Tissue: Heart: Pericardium
C1534133	Biochain	40 reactions	EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Monkey (Rhesus) Normal Tissue: Lymph Node
C1534161	Biochain	40 reactions	EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Monkey (Rhesus) Normal Tissue: Skeletal Muscle
C1534171	Biochain	40 reactions	EUR 376
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Monkey (Rhesus) Normal Tissue: Small Intestine
C1534226	Biochain	40 reactions	EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Monkey (Rhesus) Normal Tissue: Spinal Cord
C1534234	Biochain	40 reactions	EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Monkey (Rhesus) Normal Tissue: Stomach: Cardia
C1534250	Biochain	40 reactions	EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Monkey (Rhesus) Normal Tissue: Stomach: Corpus
C1534251	Biochain	40 reactions	EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Monkey (Rhesus) Normal Tissue: Stomach: Fundus
C1534252	Biochain	40 reactions	EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Monkey (Rhesus) Normal Tissue: Stomach: Pylorus
C1534253	Biochain	40 reactions	EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Monkey (Rhesus) Normal Tissue: Uterus: Cervix
C1534275	Biochain	40 reactions	EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Monkey (Rhesus) Normal Tissue: Uterus: Corpus
C1534276	Biochain	40 reactions	EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Monkey (Rhesus) Normal Tissue: Uterus: Fundus
C1534278	Biochain	40 reactions	EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Monkey (Rhesus) Normal Tissue: Blood Vessel: Artery
C1534013	Biochain	40 reactions	EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Monkey (Rhesus) Normal Tissue: Blood Vessel: Vein
C1534020	Biochain	40 reactions	EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Monkey (Rhesus) Normal Tissue: Small Intestine: Duodenum
C1534101	Biochain	40 reactions	EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Monkey (Rhesus) Normal Tissue: Liver: Left Lobe
C1534150	Biochain	40 reactions	EUR 376
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Monkey (Rhesus) Normal Tissue: Liver: Right Lobe
C1534151	Biochain	40 reactions	EUR 376
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Monkey (Rhesus) Normal Tissue: Small Intestine: Ileum
C1534227	Biochain	40 reactions	EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Monkey (Rhesus) Normal Tissue: Small Intestine: Jejunum
C1534230	Biochain	40 reactions	EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

SAA1, monkey (rhesus macaque)
RC326-12	Bio Basic	2ug	EUR 104.38
Product category: Proteins/Recombinant Proteins/Other

Immunoglobulin A (IgA) Polyclonal Antibody (Rhesus monkey)
4-PAA546Si01	Cloud-Clone	EUR 310.00 EUR 3500.00 EUR 850.00 EUR 400.00 EUR 241.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Inquire for antigen sequence. Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rhesus monkey Immunoglobulin A (IgA)

Cathepsin K (CTSK) Monoclonal Antibody (Rhesus monkey)
4-MAA267Si21	Cloud-Clone	EUR 278.00 EUR 3011.00 EUR 739.00 EUR 355.00 EUR 227.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Pro116~Met329 Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Rhesus monkey Cathepsin K (CTSK)

Interferon Alpha (IFNa) Polyclonal Antibody (Rhesus monkey)
4-PAA033Si01	Cloud-Clone	EUR 270.00 EUR 2879.00 EUR 709.00 EUR 343.00 EUR 224.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Inquire for antigen sequence. Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rhesus monkey Interferon Alpha (IFNa)

Cyclophilin A (CYPA) Polyclonal Antibody (Rhesus monkey)
4-PAA979Si01	Cloud-Clone	EUR 270.00 EUR 2879.00 EUR 709.00 EUR 343.00 EUR 224.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CYPA (Val2~Glu165) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rhesus monkey Cyclophilin A (CYPA)

Interleukin 5 (IL5) Polyclonal Antibody (Rhesus monkey)
4-PAA078Si01	Cloud-Clone	EUR 269.00 EUR 2866.00 EUR 706.00 EUR 342.00 EUR 223.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL5 (Ile20~Ser134) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rhesus monkey Interleukin 5 (IL5)

Interleukin 6 (IL6) Polyclonal Antibody (Rhesus monkey)
4-PAA079Si01	Cloud-Clone	EUR 270.00 EUR 2879.00 EUR 709.00 EUR 343.00 EUR 224.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL6 (Pro27~Met212) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rhesus monkey Interleukin 6 (IL6)

Interleukin 8 (IL8) Polyclonal Antibody (Rhesus monkey)
4-PAA080Si01	Cloud-Clone	EUR 251.00 EUR 2576.00 EUR 640.00 EUR 316.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL8 (Ala23~Pro101) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rhesus monkey Interleukin 8 (IL8)

Interleukin 8 (IL8) Monoclonal Antibody (Rhesus monkey)
4-MAA080Si21	Cloud-Clone	EUR 259.00 EUR 2708.00 EUR 670.00 EUR 328.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Ala23~Pro101 Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Rhesus monkey Interleukin 8 (IL8)

Interleukin 8 (IL8) Monoclonal Antibody (Rhesus monkey)
4-MAA080Si22	Cloud-Clone	EUR 259.00 EUR 2708.00 EUR 670.00 EUR 328.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Inquire for antigen sequence. Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Rhesus monkey Interleukin 8 (IL8)

Monkey CD4 ELISA Kit
EMKC0011	Abclonal	96Tests	EUR 521

Monoclonal CD4 Antibody (clone 5D9), Clone: 5D9
AMM02279G	Leading Biology	0.05ml	EUR 484
Description: A Monoclonal antibody against Human CD4 (clone 5D9). The antibodies are raised in Mouse and are from clone 5D9. This antibody is applicable in WB and IHC-P

Immunoglobulin A (IgA) Polyclonal Antibody (Rhesus monkey), APC
4-PAA546Si01-APC	Cloud-Clone	EUR 440.00 EUR 4625.00 EUR 1250.00 EUR 575.00 EUR 260.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Inquire for antigen sequence. Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rhesus monkey Immunoglobulin A (IgA). This antibody is labeled with APC.

Immunoglobulin A (IgA) Polyclonal Antibody (Rhesus monkey), Biotinylated
4-PAA546Si01-Biotin	Cloud-Clone	EUR 381.00 EUR 3450.00 EUR 975.00 EUR 480.00 EUR 249.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Inquire for antigen sequence. Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rhesus monkey Immunoglobulin A (IgA). This antibody is labeled with Biotin.

Immunoglobulin A (IgA) Polyclonal Antibody (Rhesus monkey), Cy3
4-PAA546Si01-Cy3	Cloud-Clone	EUR 545.00 EUR 6125.00 EUR 1625.00 EUR 725.00 EUR 305.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Inquire for antigen sequence. Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rhesus monkey Immunoglobulin A (IgA). This antibody is labeled with Cy3.

Immunoglobulin A (IgA) Polyclonal Antibody (Rhesus monkey), FITC
4-PAA546Si01-FITC	Cloud-Clone	EUR 372.00 EUR 3720.00 EUR 1020.00 EUR 480.00 EUR 228.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Inquire for antigen sequence. Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rhesus monkey Immunoglobulin A (IgA). This antibody is labeled with FITC.

Immunoglobulin A (IgA) Polyclonal Antibody (Rhesus monkey), HRP
4-PAA546Si01-HRP	Cloud-Clone	EUR 398.00 EUR 4025.00 EUR 1100.00 EUR 515.00 EUR 242.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Inquire for antigen sequence. Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rhesus monkey Immunoglobulin A (IgA). This antibody is labeled with HRP.

Immunoglobulin A (IgA) Polyclonal Antibody (Rhesus monkey), PE
4-PAA546Si01-PE	Cloud-Clone	EUR 372.00 EUR 3720.00 EUR 1020.00 EUR 480.00 EUR 228.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Inquire for antigen sequence. Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rhesus monkey Immunoglobulin A (IgA). This antibody is labeled with PE.

Hemoglobin (HB) Polyclonal Antibody (Human, Rhesus monkey, Dog)
4-PAB409Si01	Cloud-Clone	EUR 280.00 EUR 3024.00 EUR 742.00 EUR 356.00 EUR 227.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Native Protein Hemoglobin Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rhesus monkey, Dog Hemoglobin (HB)

Carbonic Anhydrase II (CA2) Monoclonal Antibody (Rhesus monkey)
4-MAA782Si22	Cloud-Clone	EUR 259.00 EUR 2708.00 EUR 670.00 EUR 328.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Inquire for antigen sequence. Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Rhesus monkey Carbonic Anhydrase II (CA2)

Cathepsin K (CTSK) Monoclonal Antibody (Rhesus monkey), APC
4-MAA267Si21-APC	Cloud-Clone	EUR 393.00 EUR 3959.00 EUR 1083.00 EUR 508.00 EUR 240.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Pro116~Met329 Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Rhesus monkey Cathepsin K (CTSK). This antibody is labeled with APC.

Cathepsin K (CTSK) Monoclonal Antibody (Rhesus monkey), Biotinylated
4-MAA267Si21-Biotin	Cloud-Clone	EUR 346.00 EUR 2961.00 EUR 852.00 EUR 431.00 EUR 234.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Pro116~Met329 Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Rhesus monkey Cathepsin K (CTSK). This antibody is labeled with Biotin.

Cathepsin K (CTSK) Monoclonal Antibody (Rhesus monkey), Cy3
4-MAA267Si21-Cy3	Cloud-Clone	EUR 482.00 EUR 5237.00 EUR 1403.00 EUR 636.00 EUR 278.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Pro116~Met329 Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Rhesus monkey Cathepsin K (CTSK). This antibody is labeled with Cy3.

Cathepsin K (CTSK) Monoclonal Antibody (Rhesus monkey), FITC
4-MAA267Si21-FITC	Cloud-Clone	EUR 334.00 EUR 3187.00 EUR 886.00 EUR 426.00 EUR 212.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Pro116~Met329 Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Rhesus monkey Cathepsin K (CTSK). This antibody is labeled with FITC.

Cathepsin K (CTSK) Monoclonal Antibody (Rhesus monkey), HRP
4-MAA267Si21-HRP	Cloud-Clone	EUR 357.00 EUR 3447.00 EUR 955.00 EUR 457.00 EUR 224.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Pro116~Met329 Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Rhesus monkey Cathepsin K (CTSK). This antibody is labeled with HRP.

Cathepsin K (CTSK) Monoclonal Antibody (Rhesus monkey), PE
4-MAA267Si21-PE	Cloud-Clone	EUR 334.00 EUR 3187.00 EUR 886.00 EUR 426.00 EUR 212.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Pro116~Met329 Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Rhesus monkey Cathepsin K (CTSK). This antibody is labeled with PE.

Glycated Hemoglobin A1c (HbA1c) Polyclonal Antibody (Rhesus monkey)
4-PAA190Si01	Cloud-Clone	EUR 269.00 EUR 2866.00 EUR 706.00 EUR 342.00 EUR 223.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Native Protein Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rhesus monkey Glycated Hemoglobin A1c (HbA1c)

Interferon Alpha (IFNa) Polyclonal Antibody (Rhesus monkey), APC
4-PAA033Si01-APC	Cloud-Clone	EUR 380.00 EUR 3779.00 EUR 1038.00 EUR 490.00 EUR 234.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Inquire for antigen sequence. Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rhesus monkey Interferon Alpha (IFNa). This antibody is labeled with APC.

Interferon Alpha (IFNa) Polyclonal Antibody (Rhesus monkey), Biotinylated
4-PAA033Si01-Biotin	Cloud-Clone	EUR 337.00 EUR 2829.00 EUR 819.00 EUR 417.00 EUR 230.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Inquire for antigen sequence. Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rhesus monkey Interferon Alpha (IFNa). This antibody is labeled with Biotin.

Interferon Alpha (IFNa) Polyclonal Antibody (Rhesus monkey), Cy3
4-PAA033Si01-Cy3	Cloud-Clone	EUR 465.00 EUR 4997.00 EUR 1343.00 EUR 612.00 EUR 271.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Inquire for antigen sequence. Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rhesus monkey Interferon Alpha (IFNa). This antibody is labeled with Cy3.

Interferon Alpha (IFNa) Polyclonal Antibody (Rhesus monkey), FITC
4-PAA033Si01-FITC	Cloud-Clone	EUR 324.00 EUR 3043.00 EUR 850.00 EUR 412.00 EUR 207.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Inquire for antigen sequence. Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rhesus monkey Interferon Alpha (IFNa). This antibody is labeled with FITC.

Interferon Alpha (IFNa) Polyclonal Antibody (Rhesus monkey), HRP
4-PAA033Si01-HRP	Cloud-Clone	EUR 346.00 EUR 3291.00 EUR 916.00 EUR 441.00 EUR 220.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Inquire for antigen sequence. Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rhesus monkey Interferon Alpha (IFNa). This antibody is labeled with HRP.

Interferon Alpha (IFNa) Polyclonal Antibody (Rhesus monkey), PE
4-PAA033Si01-PE	Cloud-Clone	EUR 324.00 EUR 3043.00 EUR 850.00 EUR 412.00 EUR 207.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Inquire for antigen sequence. Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rhesus monkey Interferon Alpha (IFNa). This antibody is labeled with PE.

Cyclophilin A (CYPA) Polyclonal Antibody (Rhesus monkey), APC
4-PAA979Si01-APC	Cloud-Clone	EUR 380.00 EUR 3779.00 EUR 1038.00 EUR 490.00 EUR 234.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CYPA (Val2~Glu165) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rhesus monkey Cyclophilin A (CYPA). This antibody is labeled with APC.

Cyclophilin A (CYPA) Polyclonal Antibody (Rhesus monkey), Biotinylated
4-PAA979Si01-Biotin	Cloud-Clone	EUR 337.00 EUR 2829.00 EUR 819.00 EUR 417.00 EUR 230.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CYPA (Val2~Glu165) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rhesus monkey Cyclophilin A (CYPA). This antibody is labeled with Biotin.

Cyclophilin A (CYPA) Polyclonal Antibody (Rhesus monkey), Cy3
4-PAA979Si01-Cy3	Cloud-Clone	EUR 465.00 EUR 4997.00 EUR 1343.00 EUR 612.00 EUR 271.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CYPA (Val2~Glu165) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rhesus monkey Cyclophilin A (CYPA). This antibody is labeled with Cy3.

Cyclophilin A (CYPA) Polyclonal Antibody (Rhesus monkey), FITC
4-PAA979Si01-FITC	Cloud-Clone	EUR 324.00 EUR 3043.00 EUR 850.00 EUR 412.00 EUR 207.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CYPA (Val2~Glu165) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rhesus monkey Cyclophilin A (CYPA). This antibody is labeled with FITC.

Cyclophilin A (CYPA) Polyclonal Antibody (Rhesus monkey), HRP
4-PAA979Si01-HRP	Cloud-Clone	EUR 346.00 EUR 3291.00 EUR 916.00 EUR 441.00 EUR 220.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CYPA (Val2~Glu165) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rhesus monkey Cyclophilin A (CYPA). This antibody is labeled with HRP.

Cyclophilin A (CYPA) Polyclonal Antibody (Rhesus monkey), PE
4-PAA979Si01-PE	Cloud-Clone	EUR 324.00 EUR 3043.00 EUR 850.00 EUR 412.00 EUR 207.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CYPA (Val2~Glu165) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rhesus monkey Cyclophilin A (CYPA). This antibody is labeled with PE.

Interleukin 5 (IL5) Polyclonal Antibody (Rhesus monkey), APC
4-PAA078Si01-APC	Cloud-Clone	EUR 379.00 EUR 3761.00 EUR 1034.00 EUR 488.00 EUR 233.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL5 (Ile20~Ser134) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rhesus monkey Interleukin 5 (IL5). This antibody is labeled with APC.

Interleukin 5 (IL5) Polyclonal Antibody (Rhesus monkey), Biotinylated
4-PAA078Si01-Biotin	Cloud-Clone	EUR 336.00 EUR 2816.00 EUR 816.00 EUR 416.00 EUR 229.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL5 (Ile20~Ser134) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rhesus monkey Interleukin 5 (IL5). This antibody is labeled with Biotin.

Interleukin 5 (IL5) Polyclonal Antibody (Rhesus monkey), Cy3
4-PAA078Si01-Cy3	Cloud-Clone	EUR 464.00 EUR 4973.00 EUR 1337.00 EUR 609.00 EUR 270.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL5 (Ile20~Ser134) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rhesus monkey Interleukin 5 (IL5). This antibody is labeled with Cy3.

Interleukin 5 (IL5) Polyclonal Antibody (Rhesus monkey), FITC
4-PAA078Si01-FITC	Cloud-Clone	EUR 323.00 EUR 3028.00 EUR 847.00 EUR 410.00 EUR 207.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL5 (Ile20~Ser134) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rhesus monkey Interleukin 5 (IL5). This antibody is labeled with FITC.

Interleukin 5 (IL5) Polyclonal Antibody (Rhesus monkey), HRP
4-PAA078Si01-HRP	Cloud-Clone	EUR 345.00 EUR 3276.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL5 (Ile20~Ser134) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rhesus monkey Interleukin 5 (IL5). This antibody is labeled with HRP.

Interleukin 5 (IL5) Polyclonal Antibody (Rhesus monkey), PE
4-PAA078Si01-PE	Cloud-Clone	EUR 323.00 EUR 3028.00 EUR 847.00 EUR 410.00 EUR 207.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL5 (Ile20~Ser134) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rhesus monkey Interleukin 5 (IL5). This antibody is labeled with PE.

Interleukin 6 (IL6) Polyclonal Antibody (Rhesus monkey), APC
4-PAA079Si01-APC	Cloud-Clone	EUR 380.00 EUR 3779.00 EUR 1038.00 EUR 490.00 EUR 234.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL6 (Pro27~Met212) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rhesus monkey Interleukin 6 (IL6). This antibody is labeled with APC.

Interleukin 6 (IL6) Polyclonal Antibody (Rhesus monkey), Biotinylated
4-PAA079Si01-Biotin	Cloud-Clone	EUR 337.00 EUR 2829.00 EUR 819.00 EUR 417.00 EUR 230.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL6 (Pro27~Met212) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rhesus monkey Interleukin 6 (IL6). This antibody is labeled with Biotin.

Interleukin 6 (IL6) Polyclonal Antibody (Rhesus monkey), Cy3
4-PAA079Si01-Cy3	Cloud-Clone	EUR 465.00 EUR 4997.00 EUR 1343.00 EUR 612.00 EUR 271.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL6 (Pro27~Met212) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rhesus monkey Interleukin 6 (IL6). This antibody is labeled with Cy3.

Interleukin 6 (IL6) Polyclonal Antibody (Rhesus monkey), FITC
4-PAA079Si01-FITC	Cloud-Clone	EUR 324.00 EUR 3043.00 EUR 850.00 EUR 412.00 EUR 207.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL6 (Pro27~Met212) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rhesus monkey Interleukin 6 (IL6). This antibody is labeled with FITC.

Interleukin 6 (IL6) Polyclonal Antibody (Rhesus monkey), HRP
4-PAA079Si01-HRP	Cloud-Clone	EUR 346.00 EUR 3291.00 EUR 916.00 EUR 441.00 EUR 220.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL6 (Pro27~Met212) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rhesus monkey Interleukin 6 (IL6). This antibody is labeled with HRP.

Interleukin 6 (IL6) Polyclonal Antibody (Rhesus monkey), PE
4-PAA079Si01-PE	Cloud-Clone	EUR 324.00 EUR 3043.00 EUR 850.00 EUR 412.00 EUR 207.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL6 (Pro27~Met212) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rhesus monkey Interleukin 6 (IL6). This antibody is labeled with PE.

Interleukin 8 (IL8) Polyclonal Antibody (Rhesus monkey), APC
4-PAA080Si01-APC	Cloud-Clone	EUR 351.00 EUR 3365.00 EUR 935.00 EUR 449.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL8 (Ala23~Pro101) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rhesus monkey Interleukin 8 (IL8). This antibody is labeled with APC.

Interleukin 8 (IL8) Polyclonal Antibody (Rhesus monkey), Biotinylated
4-PAA080Si01-Biotin	Cloud-Clone	EUR 316.00 EUR 2526.00 EUR 744.00 EUR 387.00 EUR 221.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL8 (Ala23~Pro101) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rhesus monkey Interleukin 8 (IL8). This antibody is labeled with Biotin.

Interleukin 8 (IL8) Polyclonal Antibody (Rhesus monkey), Cy3
4-PAA080Si01-Cy3	Cloud-Clone	EUR 427.00 EUR 4445.00 EUR 1205.00 EUR 557.00 EUR 254.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL8 (Ala23~Pro101) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rhesus monkey Interleukin 8 (IL8). This antibody is labeled with Cy3.

Interleukin 8 (IL8) Polyclonal Antibody (Rhesus monkey), FITC
4-PAA080Si01-FITC	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL8 (Ala23~Pro101) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rhesus monkey Interleukin 8 (IL8). This antibody is labeled with FITC.

Interleukin 8 (IL8) Polyclonal Antibody (Rhesus monkey), HRP
4-PAA080Si01-HRP	Cloud-Clone	EUR 321.00 EUR 2933.00 EUR 827.00 EUR 405.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL8 (Ala23~Pro101) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rhesus monkey Interleukin 8 (IL8). This antibody is labeled with HRP.

Interleukin 8 (IL8) Polyclonal Antibody (Rhesus monkey), PE
4-PAA080Si01-PE	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL8 (Ala23~Pro101) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rhesus monkey Interleukin 8 (IL8). This antibody is labeled with PE.

Interleukin 6 (IL6) Monoclonal Antibody (Human, Rhesus monkey)
4-MAA079Si22	Cloud-Clone	EUR 278.00 EUR 3011.00 EUR 739.00 EUR 355.00 EUR 227.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Pro27~Met212 Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Mouse monoclonal antibody against Human, Rhesus monkey Interleukin 6 (IL6)

Interleukin 8 (IL8) Monoclonal Antibody (Rhesus monkey), APC
4-MAA080Si21-APC	Cloud-Clone	EUR 364.00 EUR 3545.00 EUR 980.00 EUR 467.00 EUR 227.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Ala23~Pro101 Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Rhesus monkey Interleukin 8 (IL8). This antibody is labeled with APC.

Interleukin 8 (IL8) Monoclonal Antibody (Rhesus monkey), Biotinylated
4-MAA080Si21-Biotin	Cloud-Clone	EUR 325.00 EUR 2658.00 EUR 777.00 EUR 400.00 EUR 225.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Ala23~Pro101 Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Rhesus monkey Interleukin 8 (IL8). This antibody is labeled with Biotin.

Interleukin 8 (IL8) Monoclonal Antibody (Rhesus monkey), Cy3
4-MAA080Si21-Cy3	Cloud-Clone	EUR 444.00 EUR 4685.00 EUR 1265.00 EUR 581.00 EUR 261.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Ala23~Pro101 Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Rhesus monkey Interleukin 8 (IL8). This antibody is labeled with Cy3.

Interleukin 8 (IL8) Monoclonal Antibody (Rhesus monkey), FITC
4-MAA080Si21-FITC	Cloud-Clone	EUR 311.00 EUR 2856.00 EUR 804.00 EUR 393.00 EUR 202.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Ala23~Pro101 Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Rhesus monkey Interleukin 8 (IL8). This antibody is labeled with FITC.

Interleukin 8 (IL8) Monoclonal Antibody (Rhesus monkey), HRP
4-MAA080Si21-HRP	Cloud-Clone	EUR 332.00 EUR 3089.00 EUR 866.00 EUR 421.00 EUR 213.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Ala23~Pro101 Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Rhesus monkey Interleukin 8 (IL8). This antibody is labeled with HRP.

Interleukin 8 (IL8) Monoclonal Antibody (Rhesus monkey), PE
4-MAA080Si21-PE	Cloud-Clone	EUR 311.00 EUR 2856.00 EUR 804.00 EUR 393.00 EUR 202.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Ala23~Pro101 Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Rhesus monkey Interleukin 8 (IL8). This antibody is labeled with PE.

Interleukin 8 (IL8) Monoclonal Antibody (Rhesus monkey), APC
4-MAA080Si22-APC	Cloud-Clone	EUR 364.00 EUR 3545.00 EUR 980.00 EUR 467.00 EUR 227.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Inquire for antigen sequence. Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Rhesus monkey Interleukin 8 (IL8). This antibody is labeled with APC.

Interleukin 8 (IL8) Monoclonal Antibody (Rhesus monkey), Biotinylated
4-MAA080Si22-Biotin	Cloud-Clone	EUR 325.00 EUR 2658.00 EUR 777.00 EUR 400.00 EUR 225.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Inquire for antigen sequence. Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Rhesus monkey Interleukin 8 (IL8). This antibody is labeled with Biotin.

Interleukin 8 (IL8) Monoclonal Antibody (Rhesus monkey), Cy3
4-MAA080Si22-Cy3	Cloud-Clone	EUR 444.00 EUR 4685.00 EUR 1265.00 EUR 581.00 EUR 261.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Inquire for antigen sequence. Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Rhesus monkey Interleukin 8 (IL8). This antibody is labeled with Cy3.

Interleukin 8 (IL8) Monoclonal Antibody (Rhesus monkey), FITC
4-MAA080Si22-FITC	Cloud-Clone	EUR 311.00 EUR 2856.00 EUR 804.00 EUR 393.00 EUR 202.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Inquire for antigen sequence. Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Rhesus monkey Interleukin 8 (IL8). This antibody is labeled with FITC.

Interleukin 8 (IL8) Monoclonal Antibody (Rhesus monkey), HRP
4-MAA080Si22-HRP	Cloud-Clone	EUR 332.00 EUR 3089.00 EUR 866.00 EUR 421.00 EUR 213.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Inquire for antigen sequence. Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Rhesus monkey Interleukin 8 (IL8). This antibody is labeled with HRP.

Interleukin 8 (IL8) Monoclonal Antibody (Rhesus monkey), PE
4-MAA080Si22-PE	Cloud-Clone	EUR 311.00 EUR 2856.00 EUR 804.00 EUR 393.00 EUR 202.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Inquire for antigen sequence. Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Rhesus monkey Interleukin 8 (IL8). This antibody is labeled with PE.

Rabbit anti Rhesus Monkey IgG
FNSA-0092	FN Test	500 uL	EUR 306.6
Description: Rabbit anti Rhesus Monkey IgG secondary antibody

Rabbit anti Rhesus Monkey IgM
FNSA-0093	FN Test	500 uL	EUR 306.6
Description: Rabbit anti Rhesus Monkey IgM secondary antibody

Genomic DNA - Rhesus Monkey Male
D1534999-G01	Biochain	100 ug	EUR 188
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

Genomic DNA - Rhesus Monkey Female
D1534999-G02	Biochain	100 ug	EUR 188
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

Monkey (Rhesus) Methylated DNA Control
D6534149	Biochain	5 ug	Ask for price
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

Non-sterile Rhesus monkey serum
RMS05-0050	Equitech	50 ml	EUR 741
Non-sterile Rhesus monkey serum is indicated as RUO. Do not use on humans.

Non-sterile Rhesus monkey serum
RMS05-0100	Equitech	100 ml	EUR 1140.1
Non-sterile Rhesus monkey serum is indicated as RUO. Do not use on humans.

Non-sterile Rhesus monkey serum
RMS05-0500	Equitech	500 ml	Ask for price
Non-sterile Rhesus monkey serum is indicated as RUO. Do not use on humans.

Monoclonal CD4 Antibody, Clone: B486A1
APR15351G	Leading Biology	0.1ml	EUR 484
Description: A Monoclonal antibody against Human CD4. The antibodies are raised in Mouse and are from clone B486A1. This antibody is applicable in FC, E

Human Cluster Of Differentiation 4 (CD4) ELISA Kit
DLR-CD4-Hu-48T	DL Develop	48T	EUR 498
Should the Human Cluster Of Differentiation 4 (CD4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Cluster Of Differentiation 4 (CD4) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Cluster Of Differentiation 4 (CD4) ELISA Kit
DLR-CD4-Hu-96T	DL Develop	96T	EUR 647
Should the Human Cluster Of Differentiation 4 (CD4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Cluster Of Differentiation 4 (CD4) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Cluster Of Differentiation 4 (CD4) ELISA Kit
DLR-CD4-Mu-48T	DL Develop	48T	EUR 508
Should the Mouse Cluster Of Differentiation 4 (CD4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Cluster Of Differentiation 4 (CD4) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Cluster Of Differentiation 4 (CD4) ELISA Kit
DLR-CD4-Mu-96T	DL Develop	96T	EUR 661
Should the Mouse Cluster Of Differentiation 4 (CD4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Cluster Of Differentiation 4 (CD4) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat Cluster Of Differentiation 4 (CD4) ELISA Kit
DLR-CD4-Ra-48T	DL Develop	48T	EUR 528
Should the Rat Cluster Of Differentiation 4 (CD4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Cluster Of Differentiation 4 (CD4) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat Cluster Of Differentiation 4 (CD4) ELISA Kit
DLR-CD4-Ra-96T	DL Develop	96T	EUR 690
Should the Rat Cluster Of Differentiation 4 (CD4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Cluster Of Differentiation 4 (CD4) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Cluster Of Differentiation 4 (CD4) ELISA Kit
RD-CD4-Hu-48Tests	Reddot Biotech	48 Tests	EUR 500

Human Cluster Of Differentiation 4 (CD4) ELISA Kit
RD-CD4-Hu-96Tests	Reddot Biotech	96 Tests	EUR 692

Mouse Cluster Of Differentiation 4 (CD4) ELISA Kit
RD-CD4-Mu-48Tests	Reddot Biotech	48 Tests	EUR 511

Mouse Cluster Of Differentiation 4 (CD4) ELISA Kit
RD-CD4-Mu-96Tests	Reddot Biotech	96 Tests	EUR 709

Rat Cluster Of Differentiation 4 (CD4) ELISA Kit
RD-CD4-Ra-48Tests	Reddot Biotech	48 Tests	EUR 534

Rat Cluster Of Differentiation 4 (CD4) ELISA Kit
RD-CD4-Ra-96Tests	Reddot Biotech	96 Tests	EUR 742

Human Cluster Of Differentiation 4 (CD4) ELISA Kit
RDR-CD4-Hu-48Tests	Reddot Biotech	48 Tests	EUR 522

Human Cluster Of Differentiation 4 (CD4) ELISA Kit
RDR-CD4-Hu-96Tests	Reddot Biotech	96 Tests	EUR 724

Mouse Cluster Of Differentiation 4 (CD4) ELISA Kit
RDR-CD4-Mu-48Tests	Reddot Biotech	48 Tests	EUR 534

Mouse Cluster Of Differentiation 4 (CD4) ELISA Kit
RDR-CD4-Mu-96Tests	Reddot Biotech	96 Tests	EUR 742

Rat Cluster Of Differentiation 4 (CD4) ELISA Kit
RDR-CD4-Ra-48Tests	Reddot Biotech	48 Tests	EUR 558

Rat Cluster Of Differentiation 4 (CD4) ELISA Kit
RDR-CD4-Ra-96Tests	Reddot Biotech	96 Tests	EUR 776

Rhesus macaque CD4 Protein (Lys 26-Trp 390) [His]
VAng-1300Lsx-100g	Creative Biolabs	100 µg	EUR 738
Description: Rhesus macaque CD4, His tag, is expressed in HEK 293 cells. (Uniprot ID: G7N5T8)

Rhesus macaque CD4 Protein (Lys 26-Trp 390) [His]
VAng-1300Lsx-1mg	Creative Biolabs	1 mg	EUR 4449
Description: Rhesus macaque CD4, His tag, is expressed in HEK 293 cells. (Uniprot ID: G7N5T8)

Immunoglobulin A (IgA) Polyclonal Antibody (Rhesus monkey), APC-Cy7
4-PAA546Si01-APC-Cy7	Cloud-Clone	EUR 760.00 EUR 9130.00 EUR 2380.00 EUR 1030.00 EUR 400.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Inquire for antigen sequence. Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rhesus monkey Immunoglobulin A (IgA). This antibody is labeled with APC-Cy7.

Albumin (ALB) Polyclonal Antibody (Human, Rat, Rhesus monkey, Bovine)
4-PAB028Si01	Cloud-Clone	EUR 280.00 EUR 3024.00 EUR 742.00 EUR 356.00 EUR 227.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Native Protein ALB Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat, Rhesus monkey, Bovine Albumin (ALB)

Hemoglobin (HB) Polyclonal Antibody (Human, Rhesus monkey, Dog), APC
4-PAB409Si01-APC	Cloud-Clone	EUR 395.00 EUR 3977.00 EUR 1088.00 EUR 510.00 EUR 240.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Native Protein Hemoglobin Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rhesus monkey, Dog Hemoglobin (HB). This antibody is labeled with APC.

Hemoglobin (HB) Polyclonal Antibody (Human, Rhesus monkey, Dog), Biotinylated
4-PAB409Si01-Biotin	Cloud-Clone	EUR 348.00 EUR 2974.00 EUR 856.00 EUR 432.00 EUR 234.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Native Protein Hemoglobin Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rhesus monkey, Dog Hemoglobin (HB). This antibody is labeled with Biotin.

Hemoglobin (HB) Polyclonal Antibody (Human, Rhesus monkey, Dog), Cy3
4-PAB409Si01-Cy3	Cloud-Clone	EUR 485.00 EUR 5261.00 EUR 1409.00 EUR 638.00 EUR 278.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Native Protein Hemoglobin Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rhesus monkey, Dog Hemoglobin (HB). This antibody is labeled with Cy3.

Hemoglobin (HB) Polyclonal Antibody (Human, Rhesus monkey, Dog), FITC
4-PAB409Si01-FITC	Cloud-Clone	EUR 336.00 EUR 3201.00 EUR 890.00 EUR 428.00 EUR 212.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Native Protein Hemoglobin Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rhesus monkey, Dog Hemoglobin (HB). This antibody is labeled with FITC.

Hemoglobin (HB) Polyclonal Antibody (Human, Rhesus monkey, Dog), HRP
4-PAB409Si01-HRP	Cloud-Clone	EUR 359.00 EUR 3463.00 EUR 959.00 EUR 458.00 EUR 224.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Native Protein Hemoglobin Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rhesus monkey, Dog Hemoglobin (HB). This antibody is labeled with HRP.

Hemoglobin (HB) Polyclonal Antibody (Human, Rhesus monkey, Dog), PE
4-PAB409Si01-PE	Cloud-Clone	EUR 336.00 EUR 3201.00 EUR 890.00 EUR 428.00 EUR 212.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Native Protein Hemoglobin Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rhesus monkey, Dog Hemoglobin (HB). This antibody is labeled with PE.

Carbonic Anhydrase II (CA2) Monoclonal Antibody (Rhesus monkey), APC
4-MAA782Si22-APC	Cloud-Clone	EUR 364.00 EUR 3545.00 EUR 980.00 EUR 467.00 EUR 227.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Inquire for antigen sequence. Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Rhesus monkey Carbonic Anhydrase II (CA2). This antibody is labeled with APC.

Carbonic Anhydrase II (CA2) Monoclonal Antibody (Rhesus monkey), Biotinylated
4-MAA782Si22-Biotin	Cloud-Clone	EUR 325.00 EUR 2658.00 EUR 777.00 EUR 400.00 EUR 225.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Inquire for antigen sequence. Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Rhesus monkey Carbonic Anhydrase II (CA2). This antibody is labeled with Biotin.

Carbonic Anhydrase II (CA2) Monoclonal Antibody (Rhesus monkey), Cy3
4-MAA782Si22-Cy3	Cloud-Clone	EUR 444.00 EUR 4685.00 EUR 1265.00 EUR 581.00 EUR 261.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Inquire for antigen sequence. Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Rhesus monkey Carbonic Anhydrase II (CA2). This antibody is labeled with Cy3.

Carbonic Anhydrase II (CA2) Monoclonal Antibody (Rhesus monkey), FITC
4-MAA782Si22-FITC	Cloud-Clone	EUR 311.00 EUR 2856.00 EUR 804.00 EUR 393.00 EUR 202.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Inquire for antigen sequence. Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Rhesus monkey Carbonic Anhydrase II (CA2). This antibody is labeled with FITC.

Carbonic Anhydrase II (CA2) Monoclonal Antibody (Rhesus monkey), HRP
4-MAA782Si22-HRP	Cloud-Clone	EUR 332.00 EUR 3089.00 EUR 866.00 EUR 421.00 EUR 213.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Inquire for antigen sequence. Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Rhesus monkey Carbonic Anhydrase II (CA2). This antibody is labeled with HRP.

Carbonic Anhydrase II (CA2) Monoclonal Antibody (Rhesus monkey), PE
4-MAA782Si22-PE	Cloud-Clone	EUR 311.00 EUR 2856.00 EUR 804.00 EUR 393.00 EUR 202.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Inquire for antigen sequence. Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Rhesus monkey Carbonic Anhydrase II (CA2). This antibody is labeled with PE.

Tumor Necrosis Factor Alpha (TNFa) Monoclonal Antibody (Rhesus monkey)
4-MAA133Si21	Cloud-Clone	EUR 278.00 EUR 3011.00 EUR 739.00 EUR 355.00 EUR 227.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Val77~Leu233 Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Rhesus monkey Tumor Necrosis Factor Alpha (TNFa)

Interleukin 1 Receptor Antagonist (IL1RA) Monoclonal Antibody (Rhesus monkey)
4-MAA223Si21	Cloud-Clone	EUR 278.00 EUR 3011.00 EUR 739.00 EUR 355.00 EUR 227.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Arg26~Glu177 Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Rhesus monkey Interleukin 1 Receptor Antagonist (IL1RA)

Cathepsin K (CTSK) Monoclonal Antibody (Rhesus monkey), APC-Cy7
4-MAA267Si21-APC-Cy7	Cloud-Clone	EUR 666.00 EUR 7798.00 EUR 2047.00 EUR 896.00 EUR 360.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Pro116~Met329 Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Rhesus monkey Cathepsin K (CTSK). This antibody is labeled with APC-Cy7.

Tumor Necrosis Factor Alpha (TNFa) Polyclonal Antibody (Rhesus monkey)
4-PAA133Si01	Cloud-Clone	EUR 270.00 EUR 2879.00 EUR 709.00 EUR 343.00 EUR 224.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TNFa (Val77~Leu233) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rhesus monkey Tumor Necrosis Factor Alpha (TNFa)

Glycated Hemoglobin A1c (HbA1c) Polyclonal Antibody (Rhesus monkey), APC
4-PAA190Si01-APC	Cloud-Clone	EUR 379.00 EUR 3761.00 EUR 1034.00 EUR 488.00 EUR 233.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Native Protein Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rhesus monkey Glycated Hemoglobin A1c (HbA1c). This antibody is labeled with APC.

Glycated Hemoglobin A1c (HbA1c) Polyclonal Antibody (Rhesus monkey), Biotinylated
4-PAA190Si01-Biotin	Cloud-Clone	EUR 336.00 EUR 2816.00 EUR 816.00 EUR 416.00 EUR 229.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Native Protein Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rhesus monkey Glycated Hemoglobin A1c (HbA1c). This antibody is labeled with Biotin.

Glycated Hemoglobin A1c (HbA1c) Polyclonal Antibody (Rhesus monkey), Cy3
4-PAA190Si01-Cy3	Cloud-Clone	EUR 464.00 EUR 4973.00 EUR 1337.00 EUR 609.00 EUR 270.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Native Protein Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rhesus monkey Glycated Hemoglobin A1c (HbA1c). This antibody is labeled with Cy3.

Glycated Hemoglobin A1c (HbA1c) Polyclonal Antibody (Rhesus monkey), FITC
4-PAA190Si01-FITC	Cloud-Clone	EUR 323.00 EUR 3028.00 EUR 847.00 EUR 410.00 EUR 207.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Native Protein Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rhesus monkey Glycated Hemoglobin A1c (HbA1c). This antibody is labeled with FITC.

Glycated Hemoglobin A1c (HbA1c) Polyclonal Antibody (Rhesus monkey), HRP
4-PAA190Si01-HRP	Cloud-Clone	EUR 345.00 EUR 3276.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Native Protein Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rhesus monkey Glycated Hemoglobin A1c (HbA1c). This antibody is labeled with HRP.

Glycated Hemoglobin A1c (HbA1c) Polyclonal Antibody (Rhesus monkey), PE
4-PAA190Si01-PE	Cloud-Clone	EUR 323.00 EUR 3028.00 EUR 847.00 EUR 410.00 EUR 207.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Native Protein Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rhesus monkey Glycated Hemoglobin A1c (HbA1c). This antibody is labeled with PE.

Interleukin 1 Receptor Antagonist (IL1RA) Polyclonal Antibody (Rhesus monkey)
4-PAA223Si01	Cloud-Clone	EUR 251.00 EUR 2576.00 EUR 640.00 EUR 316.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL1RA (Arg26~Glu177) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rhesus monkey Interleukin 1 Receptor Antagonist (IL1RA)

Interferon Alpha (IFNa) Polyclonal Antibody (Rhesus monkey), APC-Cy7
4-PAA033Si01-APC-Cy7	Cloud-Clone	EUR 641.00 EUR 7438.00 EUR 1957.00 EUR 860.00 EUR 349.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Inquire for antigen sequence. Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rhesus monkey Interferon Alpha (IFNa). This antibody is labeled with APC-Cy7.

 

Synthesis of Full-Dimension cDNA Infectious Clones of Soybean Mosaic Virus and Purposeful Identification of a Key Amino Acid throughout the Silencing Suppressor Hc-Skilled

 

• Soybean mosaic virus (SMV), which belongs to the Potyviridae, causes very important reductions in soybean yield and seed prime quality. On this look at, every tag-free and reporter gene inexperienced fluorescent protein (GFP)-containing infectious clones for the SMV N1 strain have been constructed by Gibson assembly and with the yeast homologous recombination system, respectively.

 

• Every infectious clones are acceptable for agroinfiltration on the model host benthamiana and current strong infectivity for the pure host soybean and several other different totally different legume species. Every infectious clones have been seed transmitted and prompted typical virus indicators on seeds and progeny crops. We used the SMV-GFP infectious clone to further look at the perform of key amino acids throughout the silencing suppressor helper component-proteinase (Hc-Skilled).

 

• Amongst twelve amino acid substitution mutants, the co-expression of mutant 2-with an Asparagine→Leucine substitution at place 182 of the FRNK (Phe-Arg-Asn-Lys) motif-attenuated viral indicators and alleviated the host progress retardation introduced on by SMV.

 

• Moreover, the Hc-Prom2 mutant confirmed stronger oligomerization than wild-type Hc-Skilled. Taken collectively, the SMV infectious clones may be useful for analysis of host-SMV interactions and helpful gene characterization in soybeans and related legume species, notably by means of seed transmission properties. Furthermore, the SMV-GFP infectious clone will even facilitate helpful analysis of every virus and host genes in an benthamiana transient expression system.

 

Profiling of rice Cd-tolerant genes by means of yeast-based cDNA library survival screening

The bioaccumulation of cadmium (Cd) in crop and the following meals chain has aroused intensive issues. Nonetheless, the underlying molecular mechanisms of plant Cd tolerance keep to be clarified from the viewpoint of novel candidate genes.

 

Proper right here we described a extraordinarily atmosphere pleasant technique for preliminary determining rice Cd-tolerant genes by means of the yeast-based cDNA library survival screening blended with high-throughput sequencing approach. About 690 gene isoforms have been acknowledged as being Cd-tolerant candidates using this shotgun technique.

 

Among the many many Cd-tolerant genes acknowledged, numerous lessons of genes paying homage to BAX inhibitor (BI), NAC transcription parts and Quick ALkalinization Parts (RALFs) have been of particular curiosity, and their carry out of Cd tolerance was further validated via heterologous expression, which urged that SNAC1, RALF12, OsBI-1 can confer Cd tolerance in yeast and tobacco leaves.

 

Referring to the genes involved in ion transport, the validated Cd-tolerant heavy metal-associated space (HMAD) isoprenylated protein HIPP42 was considerably noteworthy. Further elucidation of these genes associated to Cd tolerance in rice will revenue agricultural actions.

 

Single-Cell Transcriptomics of Immune Cells: Cell Isolation and cDNA Library Period for scRNA-Seq

 

Single-cell RNA-sequencing (scRNA-seq) permits an entire analysis of the transcriptome of explicit particular person cells by next-generation sequencing. ScRNA-seq provides an unbiased technique to investigate the cellular heterogeneity and dynamics of varied natural strategies, along with the immune system. Optimization of the technical procedures carried out earlier to RNA-seq analysis is essential to the success of a scRNA-seq experiment.

 

Proper right here, three essential experimental procedures are described: (1) the isolation of immune CD8a⁺ T cells from essential murine tissue, (2) the expertise of single-cell cDNA libraries using the 10× Genomics Chromium Controller and the Chromium Single Cell 3′ Reply, and (3) cDNA library prime quality administration. On this protocol, CD8a⁺ T cells are isolated from murine spleen tissue, nonetheless any cell form of curiosity may very well be enriched and used for single-cell cDNA library expertise and subsequent RNA-seq experiments.

 

Human Chemokine C-C-Motif Receptor 6 (CCR6) ELISA Kit
RDR-CCR6-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Anti-CCR6/CCR6 Antibody
PA1201	BosterBio	100ug/vial	EUR 294

CCR6
MO15087	Neuromics	100 ug	EUR 409

CCR6 siRNA
20-abx910877	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

CCR6 siRNA
20-abx910878	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

CCR6 Antibody
ABD10207	Lifescience Market	100 ug	EUR 438

CCR6 Antibody
37466-100ul	SAB	100ul	EUR 252

CCR6 antibody
10R-1071	Fitzgerald	100 ul	EUR 316
Description: Mouse monoclonal CCR6 antibody

CCR6 antibody
70R-13797	Fitzgerald	100 ug	EUR 322
Description: Affinity purified Rabbit polyclonal CCR6 antibody

CCR6 Antibody
1-CSB-PA943255	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CCR6. Recognizes CCR6 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:10000, WB:1:1000-1:5000, IHC:1:50-1:200

CCR6 Antibody
DF10207	Affbiotech	200ul	EUR 304
Description: CCR6 Antibody detects endogenous levels of total CCR6.

CCR6 Antibody
1-CSB-PA004845EA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CCR6. Recognizes CCR6 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:2000

CCR6 Antibody
1-CSB-PA244343	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CCR6. Recognizes CCR6 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:50-1:200

CCR6 Conjugated Antibody
C37466	SAB	100ul	EUR 397

CCR6 cloning plasmid
CSB-CL004845HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1125 Sequence: atgagcggggaatcaatgaatttcagcgatgttttcgactccagtgaagattattttgtgtcagtcaatacttcatattactcagttgattctgagatgttactgtgctccttgcaggaggtcaggcagttctccaggctatttgtaccgattgcctactccttgatctgtgtct Show more
Description: A cloning plasmid for the CCR6 gene.

CCR6 inhibitor 1
HY-112701	MedChemExpress	10mg	EUR 911

CCR6 Blocking Peptide
20-abx061923	Abbexa	EUR 258.00 EUR 384.00	1 mg 5 mg
Shipped within 5-10 working days.

Anti-CCR6 Antibody
A00061-1	BosterBio	200ug	EUR 397
Description: Goat Polyclonal CCR6 Antibody. Validated in ELISA, IHC and tested in Human, Mouse.

Anti-CCR6 Antibody
A00957	BosterBio	100ug/vial	EUR 334

CCR6 Polyclonal Antibody
A50105	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

CCR6 Rabbit pAb
A16206-100ul	Abclonal	100 ul	EUR 308

CCR6 Rabbit pAb
A16206-200ul	Abclonal	200 ul	EUR 459

CCR6 Rabbit pAb
A16206-20ul	Abclonal	20 ul	EUR 183

CCR6 Rabbit pAb
A16206-50ul	Abclonal	50 ul	EUR 223

CCR6 Blocking Peptide
DF10207-BP	Affbiotech	1mg	EUR 195

Anti-CCR6 Antibody
STJ500414	St John's Laboratory	100 µg	EUR 476

Anti-CCR6 antibody
STJ118659	St John's Laboratory	100 µl	EUR 277

Human CCR6 ELISA Kit
ELA-E2014h	Lifescience Market	96 Tests	EUR 824

CCR6 ELISA KIT|Human
EF006138	Lifescience Market	96 Tests	EUR 689

Human CCR6 shRNA Plasmid
20-abx950871	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse CCR6 shRNA Plasmid
20-abx969534	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

CCR6 Antibody, HRP conjugated
1-CSB-PA004845EB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CCR6. Recognizes CCR6 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

CCR6 Antibody, FITC conjugated
1-CSB-PA004845EC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CCR6. Recognizes CCR6 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

CCR6 Antibody, Biotin conjugated
1-CSB-PA004845ED01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CCR6. Recognizes CCR6 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

CCR6 Recombinant Protein (Human)
RP006232	ABM	100 ug	Ask for price

CCR6 Recombinant Protein (Rat)
RP193790	ABM	100 ug	Ask for price

CCR6 Recombinant Protein (Mouse)
RP122255	ABM	100 ug	Ask for price

CCR6 Recombinant Protein (Mouse)
RP122258	ABM	100 ug	Ask for price

CCR6 Recombinant Protein (Mouse)
RP122261	ABM	100 ug	Ask for price

CCR6 Recombinant Protein (Mouse)
RP122264	ABM	100 ug	Ask for price

CCR6 Recombinant Protein (Mouse)
RP122267	ABM	100 ug	Ask for price

CCR6 Recombinant Protein (Mouse)
RP122270	ABM	100 ug	Ask for price

CCR6 Recombinant Protein (Mouse)
RP122273	ABM	100 ug	Ask for price

Anti-CCR6 Antibody (Biotin)
STJ500416	St John's Laboratory	100 µg	EUR 586

Anti-CCR6 Antibody (FITC)

STJ500417